The fixed component is the dropdown menu which have fixed class and z index of 50. Currently, it has white background and I want to change it so it has same ba
I have just started developing c++ in Visual Studio Code and if I have a single file, for example main.cpp, the intellisense works fine and the project compiles
Work continues on migrating my HTA to a Powershell-driven, XAML-based form... Parts of the HTA use the "STYLE='display:[none|blank];'" technique to show/hide pa
I am designing a micro-service based system that will be accessed by a python SDK, from an application. The SDK will be used to access machine learning models h
I have a fasta file that reads like so: >00009c1cc42953fb4702f6331325c7cc TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGTTGTTAAGTCAGTGGTGAAATCGTGTG
As described in the title i get ArrayIndexOutOfBoundsException when i start my Tomcat 7 with NetBeans 8.2. I've tried troubleshooting with those two threads wit
I am making a column called month which reads from an importing excel file that has a column with certain strings that represent a month number. The problem I'm
I have two matrices that I'm trying to run a mantel test on. To do this, they need to be in a distance format. But, I don't want R to actually calculate the dis