I'm new at web scraping an I'm stuck with this. My goal is to generate a table with historical data from '2018-01-01' to '2021-12-31' but I have 0 idea of how t
I've been search and I can't found an answer that works, I need to remove (delete) the last line in a RichTextBox1 in vb.net, I mean remove last line and 'break
I've just been reading about std::thread and std::bind which I've faced with the Callable concept and std::invoke. I read about std::invoke on cppreference bu
I have a file containing a sequence: >sequence TAGGACTGAGGGCTGGACAGGGCTGCGGGAG and another one containing numbers refering to positions: 3 6 11 I would
I would like to plot something only for that certain candle which (or the vertical position of which) the mouse is pointed on. For example: plot(MouseIsHovering
I am new to numpy library. How values are converted to get below output and internally how the values are changed? >>> np.convolve([1, 2, 3], [0, 1,
So I have a React application setup with firebase. I have two auth methods (Email password & Google Auth). We have some custom parameters that needs to be a