Guys I try to get the 'href' because I want to go inside every one of them and download all the images inside them but I get the problem when it says has no att
runs perfectly fine on my computer does not run in my wife's, I keep getting the error Run time error "5" Invalid procedure or call argument. Im trying to creat
I have this file : >AX-899-Af-889-[A/G] GTCCATTCAGGTAAAAAAAAAAAACATAACAATTGAAATTGCATGA >AX-899-Af-889-[A/G] GCAAACTATTTTCATGAATGAACTTCAGTTGATTGTGAGATG >
For my project I am using pytorch as a linear algebra backend. For the performance part of my code, I need to do 1D convolutions of 2 small (length between 2 an
When my code issues a call like this: entityManager.find(Customer.class, customerID); How can I see the SQL query for this call? Assuming I don't have acces
I have a DataGridView with a Column already defined as ComboBox. How do I add items to that Column Combobox so that they are available in that column for each n
I'm trying to calculate the values that are in my input boxes that's in the middle of the webpage. I thought if i add the class names references in JS within a
Error: SyntaxError: Unexpected string in JSON at position 49 at JSON.parse () at parse (C:\Users\goktu\OneDrive\Masaüstü\Flipkart\node_modules\body-
A type X has a non-trivial move-constructor, which is not declared noexcept (ie. it can throw): #include <iostream> #include <vector> #include <m