I want to show a dialog on a jQuery mobile website such that: It displays when the page loads It shows the page behind it It should be dismissible by clicking o
Consider the following code: use std::net::IpAddr; pub struct Server { host: IpAddr } impl Server { fn new(host: IpAddr) -> Self { Self {ho
I have the following button: <button data-toggle="tk-modal-demo" data-modal-options="slide-left" data-dialog-options="sidebar sidebar-size-3 sidebar-size-xs
I created a mouse position program that can be used to save your mouse position {X, Y} I realised that this is not going to be effective unless I implement a me
I would like to understand what will be the difference in JS if I will call a function from an OOP including "instance" before calling the key/instance inside.
when i try to fetch data from my django server i got a NETWORK_ERROR corsheader in backend is work i just try localhost and my machine ip and notwork this is t
I am trying to get current week of the calendar. Let's assume today is 2022-03-14 12:00:00. I am using these 2: select GETDATE() // returns 2022-03-14 12:00:00
I have a file containing a sequence: >sequence TAGGACTGAGGGCTGGACAGGGCTGCGGGAG and another one containing numbers refering to positions: 3 6 11 I would
I have multiple projects that expose a Prometheus endpoint, like so: Application1: management.endpoints.web.exposure.include=info,health,prometheus Application2