Maybe you were looking for...

How would I be able to check how far apart two characters are?

Say I have two characters (in this case "S" and "E") and an unknown amount of characters in between them, how would I work it out? For example: turning "SmcfjfE

How to conditionally iterate a for loop with if loop?

I want my 2nd for loop to use a conditional vector, but when I tried putting an if loop in the vector area, the code just iterates over the 1st value in the vec

Rxdb myCollection.find().exec() returns null / previous document as response after myCollection.insert()

I am calling rxdbcollection.find() in a useEffect() hook after inserting a record into the rxdbCollection in the following way: const [recordSaved,setRecordSave

Insert pattern from current line in next line

I have this file : >AX-899-Af-889-[A/G] GTCCATTCAGGTAAAAAAAAAAAACATAACAATTGAAATTGCATGA >AX-899-Af-889-[A/G] GCAAACTATTTTCATGAATGAACTTCAGTTGATTGTGAGATG >

delete rows of and 2D array with a condition refering to a different array in python numpy

I have two numpy arrays: a = np.array([12, 13, 10]) b = np.array([[22, 123], [10, 142], [23, 232], [42, 122], [12, 239]]) I want to delete rows in b if the fir

Django serializers usage with data transfer objects

I am from Java background and I am getting a bit confused with the serialization in Django Let's say I have this requirement I need to fetch the results of stoc

Websocket, listen and broadcast at the same time

Hello I'm trying to learn node.js, I'm a old PHP coder... The reason why I'm doing that is the websockets thing... so hard with PHP and natural with node... Any

conditional validation of Angular reactive forms

I am new to angular and working on reactive form. I have a html table in which by looping through I have generated controls I want to add validation based on f